How can forward primers contribute to the development of more sensitive and specific diagnostic tests?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

FAM Forward primer. HEX Reverse primer. FAM. HEX. Base pairs. Base pairs. Forward primer Genus specific probe. Reverse primer. Fig. 4. RFLP analysis of qPCR. Gene symbol. Forward primer. Reverse primer. B2m. TTCTGGTGCTTGTCTCACTGA. CAGTATGTTCGGCTTCCCATT C. Ccl2. GCAGAGAGCCAGACGGG. ACAGCTTCTTTGGGACACCT. CAGACCTGCCTTACGACTATGG. Reversed primer. CTCGGTGGCGTTGAGATTGTT. Gpx. Forward primer. CCTTTTAAGCAGTATGCAGGCA. Reversed primer. CAAGCCAAATGGCCCAAGTT. Catalase. Sep 1, 2018 ... They twist together in a double-stranded configuration, but when you heat them enough (usually about 94–95 degrees C), the bonds break and they come unstuck. Table SII. Minor allele frequencies of single nucleotide polymorphisms rs799917 and rs2231142 in different populations. Population rs799917 (n). 3' primer (reverse primer) should align to the last 18-20 nucleotides of the anti-sense strand (complement to antisense strand). Make sure a stop codon (TAA ( ... Universal 3' miRNA Reverse Primer. Cat. No. MPH00000. Unit 150 μl / 10 μM. Price $20.00. Add to Cart. forward primer:CCTGCGCCTCAAGACCTTC. reverse primer:GTCACTGCGCTCCAGTAGAA. TGF-β1. forward primer:CCACCTGCAAGACCATCGAC. reverse primer:CTGGCGAGCCTTAGTTTGGAC. forward primers · Product Information Sheet - KSPQ12012 · Data Sheet - P3473 · Application Note - RealTime PCR Quantification of Plant ... Apr 3, 2014 ... ... forward primer and complementary sequences in reverse primer via a few bases. The method is different from current methods of nucleic ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store
  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.