Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What are chromatin immunoprecipitation (ChIP) assays?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Oct 17, 2023 ... 635022. (96 rxns). 12 µl. 12 µl. 12 µl. TCRa Human Primer 2 Reverse HT Index 1 (aR1; 12.5 μM). -. 12 µl. 12 µl. TCRa Human Primer 2 Reverse ... Mar 15, 2014 ... We used the pBS-gene as our template. We carried out four reactions, which are as followed: T7 (forward primer); T3 (reverse primer). Mouse Siglec-G forward primer, 5'-GTCCCAGACTTGCATGAGAATC;. Mouse Siglec-G reverse primer, 5'-GACCCAGCTCAGTGTAGCA;. Mouse Klre1forward primer ... 5' AGGCTGAGAACTCTCGCTTGC 3' Forward Primer. 5' GGTGCTGGTCCTCTGGTATCC 3' Reverse Primer. Murine Cxcl12. 5' CAGCCGTGCAACAATCTGAA 3' Forward Primer. 5 ... Jun 27, 2013 ... Each forward and reverse primer will be provided in its own tube (meaning, a primer pair ... Human, Forward PCR primer, M13-tailed, HPLC. M13 ... Oct 24, 2019 ... Your FWD primer is found on the reverse reads in its forward orientation. So... treat that as the reverse complement of the REV primer in the tutorial. Fusion primers contained either the A or B 454 amplicon adapter followed by a 5 nt multiplex identifier (MID; barcode) on the forward primer and ending with the ... Oct 29, 2015 ... || symbol can be used in the pattern matching step to include multiple primer sequences. Hope it helps! ADD ... forward primer ATGACAATGAATACGGCTACAGCA . GAPDH reverse primer. GCAGCGAACTTTATTGATGGTATT forward primer. TGCAGAGGATGATTGCTGAC. Bax reverse primer. Reverse primer: The reverse complement of 40bp after the gene's Stop-codon (excluding the Stop-codon from the primer), followed by the “reverse primer” sequence ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.