Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

How can these inhibitors affect the performance of forward primers in RT-PCR?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Having trouble accessing something on this page? Please send us an email and we will get back to you as quickly as we can. Banking · Research · Events ... forward primer：CCTGCGCCTCAAGACCTTC. reverse primer：GTCACTGCGCTCCAGTAGAA. TGF-β1. forward primer：CCACCTGCAAGACCATCGAC. reverse primer：CTGGCGAGCCTTAGTTTGGAC. Reverse Complement converts a DNA sequence into its reverse, complement, or reverse-complement counterpart. You may want to work with the reverse-complement ... Human U6 Forward Primer. Part Number: 600750. RUO Human U6 Forward Primer. For Research Use Only. Not for use in diagnostic procedures. Mouse Siglec-G forward primer, 5'-GTCCCAGACTTGCATGAGAATC;. Mouse Siglec-G reverse primer, 5'-GACCCAGCTCAGTGTAGCA;. Mouse Klre1forward primer ... To amplify any DNA sequence, two primers are necessary. One is called 'forward primer' and the other one is called 'reverse primer'. The forward primer ... Nov 5, 2014 ... Forward Primer: 4. Reverse Primer: 6. (self-complementary). Forward: 2. Reverse: 2. (3' self complementary). Cite · Elizabeth Reynaga. Product description: Non-Variola Orthopoxvirus Forward Primer, 20 nmol, Add to favourites, Favourite: 20 nmol, Delivered amount: NVAR-OPXV-F-20. Product ... Full Primer List ; CAT-R · GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer ; CMV Forward, CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human ... Target - If available, choose to query transcribed sequences. Forward Primer - Must be at least 15 bases in length. Reverse Primer - On the opposite strand from ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.