Are forward primers directly used on microarrays?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

forward primer:CCTGCGCCTCAAGACCTTC. reverse primer:GTCACTGCGCTCCAGTAGAA. TGF-β1. forward primer:CCACCTGCAAGACCATCGAC. reverse primer:CTGGCGAGCCTTAGTTTGGAC. Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ... Target - If available, choose to query transcribed sequences. Forward Primer - Must be at least 15 bases in length. Reverse Primer - On the opposite strand from ... Feb 15, 2022 ... GAGTACT ATGAGT ATAGTC Асстс А GA А CTCA Forward Primer: Reverse Primer: Answer 1: You Answered (You left this blank) Correct Answer CAGATCCATGG ... TK. Forward primer (gE592F): CCGCGGGCCGTGTTCTTTGT. 568. gH. Reverse primer (gE1084R): CGTGGCCGTTGTGGGTCAT. 634. gL. Forward primer (gE1066F): ... 16S V4 amplification primers · Ordering primers · 515F forward primer, barcoded · 806R reverse primer. Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below). ... pBAD Forward. 20. Mar 4, 2022 ... The Forward-Looking Analysis of Risk Events (FLARE) model is one such tool. This technical note describes the FLARE model, which is a top-down ... Reverse primer: The reverse complement of 40bp after the gene's Stop-codon (excluding the Stop-codon from the primer), followed by the “reverse primer” sequence ... Significant values (*P < 0.05) are indicated nt = nucleotide, rev = reverse primer, fwd = forward primer. To study the impact of a specific mismatch type on PCR ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store
  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.