Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What resources are available for learning more about forward primers?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Shop Applied Biosystems™ Human, Forward Primer, Desalted at Fishersci.com. Mouse Siglec-G forward primer, 5'-GTCCCAGACTTGCATGAGAATC;. Mouse Siglec-G reverse primer, 5'-GACCCAGCTCAGTGTAGCA;. Mouse Klre1forward primer ... Oct 17, 2023 ... 635022. (96 rxns). 12 µl. 12 µl. 12 µl. TCRa Human Primer 2 Reverse HT Index 1 (aR1; 12.5 μM). -. 12 µl. 12 µl. TCRa Human Primer 2 Reverse ... Jun 27, 2013 ... Each forward and reverse primer will be provided in its own tube (meaning, a primer pair ... Human, Forward PCR primer, M13-tailed, HPLC. M13 ... nCOV_N1 Forward Primer Aliquot, 50 nmol, 10006821, $250.00 SGD, Click here to order. nCOV_N1 Reverse Primer Aliquot, 50 nmol, 10006822, $250.00 SGD, Click here ... The forward primer attaches to the start codon of the template DNA (the anti-sense strand), while the reverse primer attaches to the stop codon of the ... In this study, fecal microbiota were analyzed using the T-RFLP method with three different forward primers (27F, 35F, and 529F) in conjunction with one reverse ... CAGACCTGCCTTACGACTATGG. Reversed primer. CTCGGTGGCGTTGAGATTGTT. Gpx. Forward primer. CCTTTTAAGCAGTATGCAGGCA. Reversed primer. CAAGCCAAATGGCCCAAGTT. Catalase. Gene symbol. Forward primer. Reverse primer. B2m. TTCTGGTGCTTGTCTCACTGA. CAGTATGTTCGGCTTCCCATT C. Ccl2. GCAGAGAGCCAGACGGG. ACAGCTTCTTTGGGACACCT. Because primers are read and created by humans our reverse primer need to be written from the beginning to the end. This is called the “reverse complement” of ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.