Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

Can a forward primer contribute to primer dimer formation?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Aug 3, 2009 ... The forward primer was sited in the pol gene at a position ... forward and reverse CAS pol primers, and these are likely to prevent amplification. RNase P Forward Primer Aliquot, 100 nmol, 10006836 ; RNase P Reverse Primer Aliquot, 100 nmol, 10006837 ... the template, and the first fragment's forward primer and the second fragment's reverse primer. were used as the new primer set. The second-round PCR product ... List of qRT-PCR primers. Gene. Forward primer (5' - 3'). Reverse primer (5' - 3'). MMP11. CCGCAACCGACAGAAGAGG. ATCGCTCCATACCTTTAGGGC. GAPDH. Jan 13, 2016 ... ... forward primer driven PCR. ACTA BIOLOGICA SZEGEDIENSIS, 58 (1). pp. 65-68. ISSN 1588-385X. [img]. Preview. Text ActaBiolSzeged___2014___ ... ... 11, MYL6, forward primer, fragment 1, Bisulfite-PCR, ATTTTAAGCGTTTGAGTGTTGCAGGTAGGG. 12, MYL6, reverse primer, fragment 1, Bisulfite-PCR ... Oct 4, 2020 ... This video is about how to design primers using Primer3Plus. Primer3Plus is an online tool which is used to design primers. ... Table S1. RT-PCR primer sequences. Gene. Forward primer, 5' to 3'. Reverse primer, 5' to 3'. CYCLO. CAAATGCTGGACCAAACACA. CAGTCTTGGCGGTGCAGAT. NPC1L1. Human U6 Forward Primer. Part Number: 600750. RUO Human U6 Forward Primer. For Research Use Only. Not for use in diagnostic procedures. Full Primer List ; CAT-R · GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer ; CMV Forward, CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.