Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

How can PCR with specific forward primers be used to validate RNA structure predictions?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Full Primer List ; CAT-R · GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer ; CMV Forward, CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human ... pJET1.2 Forward Sequencing Primer, 23-mer. Catalog number:SO501. Share Copy product name Copy catalog number Copy catalog number and product name. RNase P Forward Primer Aliquot, 100 nmol, 10006836 ; RNase P Reverse Primer Aliquot, 100 nmol, 10006837 ... Jan 5, 2023 ... ... forward primer (10 μM), 1.0 μL reverse primer (10 μM), 0.3 μL exo probe (10 μM), 4.75 μL nuclease-free water, 2.0 μL nucleic acid template ... Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below). ... pBAD Forward. 20. Forward primer for CYP71ADH1-LP4/2A-. ADH1. 16 AGTAGCAACTTCGTCTGCTGCATTTGATCAAAACTTAATAAGGATTTTCACGCAGTCAGG. Reverse primer for CYP71ADH1-LP4/2A-. ADH1. 17 ... Standard Primers. Sequence. Length ; T7 Promoter, 5'-TAA TAC GAC TCA CTA TAG GG-3', 20-mer ; T3 Promoter, 5'-CAA TTA ACC CTC ACT AAA GG-3', 20-mer ; M13 Forward (- ... Forward primer (5'→3'). Reverse primer (5'→3'). Murine. MMP-3. TGAAAATGAAGGGTCTTCCGG. GCAGAAGCTCCATACCAGCA. MMP-13. GATGGCACTGCTGACATCAT. TGTAGCCTTTGGAACTGCTT. Table SII. Minor allele frequencies of single nucleotide polymorphisms rs799917 and rs2231142 in different populations. Population rs799917 (n). In the picture above, the forward primer anneals to the template (-) strand, and is identical to (a part of) the template (+) strand. And the reverse primer ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.