What are phylogenetic trees?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

The students block off the DNA sequences at the beginning of their gene for the forward primer and at the end of the gene for their reverse primer and add a ... PUC/M13 (-40) Forward Primer / 17 mer (2 nmole). Universal primer for sequencing. * Formats: 2 nmole of lyophilized oligo in 1.5 ... Aug 31, 2022 ... LW043 Forward primer to amplify pBR-. lacI plasmid for Gibson cloning. GAATTCTCATGTTTGACAG. LW044 Reverse primer to amplify pBR-. lacI plasmid ... Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ... Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ... nCOV_N1 Forward Primer Aliquot, 50 nmol, 10006821, $250.00 SGD, Click here to order. nCOV_N1 Reverse Primer Aliquot, 50 nmol, 10006822, $250.00 SGD, Click here ... Results of sequencing show that the products of SDAMP amplification are mainly polymers formed by series connection of monomers formed through linkage of ... Forward Primer is a DNA stretch that attaches to the antisense strand (-) of the DNA that runs in 3' to 5' direction. The primers anneal to the DNA strand and ... Having trouble accessing something on this page? Please send us an email and we will get back to you as quickly as we can. Banking · Research · Events ... Supplemental table S1: Primer sequences. Gene symbol. Forward primer. Reverse primer. MR. GGACAATTCTTTCGTCGAATC. TTTTCTTCAAAAGAGCAGTGG. SGK1.
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store
  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.