Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What are the consequences of mismatches in a forward primer?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ... Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ... Universal 3' miRNA Reverse Primer. Cat. No. MPH00000. Unit 150 μl / 10 μM. Price $20.00. Add to Cart. Jun 14, 2013 ... This newly designed forward primer combined with the “jgHCO2198” reverse primer to target a 313 bp fragment performs well across metazoan diversity. RNase P Forward Primer Aliquot, 100 nmol, 10006836 ; RNase P Reverse Primer Aliquot, 100 nmol, 10006837 ... May 12, 2023 ... Reverse Primer · Reverse primers are DNA segments that are complementary to the sense strand of the double-stranded DNA. · They are also known ... the template, and the first fragment's forward primer and the second fragment's reverse primer. were used as the new primer set. The second-round PCR product ... Standard Primers. Sequence. Length ; T7 Promoter, 5'-TAA TAC GAC TCA CTA TAG GG-3', 20-mer ; T3 Promoter, 5'-CAA TTA ACC CTC ACT AAA GG-3', 20-mer ; M13 Forward (- ... In this study, fecal microbiota were analyzed using the T-RFLP method with three different forward primers (27F, 35F, and 529F) in conjunction with one reverse ... Feb 14, 2018 ... Are you taking mRNA sequence because you're doing reverse transcriptase PCR? How would do the same with genomic DNA, and if your forward ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.