What are mitochondrial DNA analysis?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

S0540 - Forward and Reverse Control Primer Mix. Revision date 06-May-2023. SECTION 4: First aid measures. 4.1. Description of first aid measures. Inhalation. ... Table S1. RT-PCR primer sequences. Gene. Forward primer, 5' to 3'. Reverse primer, 5' to 3'. CYCLO. CAAATGCTGGACCAAACACA. CAGTCTTGGCGGTGCAGAT. NPC1L1. Jun 14, 2013 ... This newly designed forward primer combined with the “jgHCO2198” reverse primer to target a 313 bp fragment performs well across metazoan diversity. Forward primer (5'→3'). Reverse primer (5'→3'). Murine. MMP-3. TGAAAATGAAGGGTCTTCCGG. GCAGAAGCTCCATACCAGCA. MMP-13. GATGGCACTGCTGACATCAT. TGTAGCCTTTGGAACTGCTT. Sequencing of BioBrick parts ; BBa_G00401, Reverse Primer to C0040, gcggacccactttcacatttaag, R ; BBa_G00700, Forward primer for I0500 (pBAD), agatttatcgccagcagctc ... Standard Primers. Sequence. Length ; T7 Promoter, 5'-TAA TAC GAC TCA CTA TAG GG-3', 20-mer ; T3 Promoter, 5'-CAA TTA ACC CTC ACT AAA GG-3', 20-mer ; M13 Forward (- ... Having trouble accessing something on this page? Please send us an email and we will get back to you as quickly as we can. Banking · Research · Events ... COX1. Forward Primer 5'-TCGGAGCCCCAGATATAGCA -3'. Reverse Primer. 5'-TTTCCGGCTAGAGGTGGGTA -3'. COX3. Forward Primer 5'-CAAGGCCACCACACTCCTAT -3'. GFP, H1-GFP, T-L7, T-L22 in pIB/V5-His-TOPO vector. GFP. Forward primer 5'- ACCATGGCTAGCAAAGGAGAAGAA -3'. Reverse primer 5'- TTATTTGTAGAGCTCATCCATG -3'. Primer sequences for relative genes. Gene. Forward primer. Reverse primer. hGAPDH. AGGGCTGCTTTTAACTCTGGT. CCCCACTTGATTTTGGAGGGA. hPDL1. TGGCATTTGCTGAACGCATTT.
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store
  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.