Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What are water quality testing using PCR?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Reverse primer. TCACCGCCTTGGCTTGTCAC. Rat beta-actin NM_031144.3. Forward primer CTAAGGCCAACCGTGAAAAGA. 99 bp. Reverse primer. CCAGAGGCATACAGGGACAAC. Human A2aR ... Jan 5, 2023 ... ... forward primer (10 μM), 1.0 μL reverse primer (10 μM), 0.3 μL exo probe (10 μM), 4.75 μL nuclease-free water, 2.0 μL nucleic acid template ... forward primers · Product Information Sheet - KSPQ12012 · Data Sheet - P3473 · Application Note - RealTime PCR Quantification of Plant ... Product description: Non-Variola Orthopoxvirus Forward Primer, 20 nmol, Add to favourites, Favourite: 20 nmol, Delivered amount: NVAR-OPXV-F-20. Product ... FAM Forward primer. HEX Reverse primer. FAM. HEX. Base pairs. Base pairs. Forward primer Genus specific probe. Reverse primer. Fig. 4. RFLP analysis of qPCR. In the picture above, the forward primer anneals to the template (-) strand, and is identical to (a part of) the template (+) strand. And the reverse primer ... or a Primer Pair with forward and reverse primers in separate tubes for PCR and Sanger sequencing. Suitable for 200-500 rxns depending on usage. Format *. Jan 13, 2016 ... ... forward primer driven PCR. ACTA BIOLOGICA SZEGEDIENSIS, 58 (1). pp. 65-68. ISSN 1588-385X. [img]. Preview. Text ActaBiolSzeged___2014___ ... Reverse primer: The reverse complement of 40bp after the gene's Stop-codon (excluding the Stop-codon from the primer), followed by the “reverse primer” sequence ... Full Primer List ; CAT-R · GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer ; CMV Forward, CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.