Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

How do sunrise primers function in real-time PCR?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Gene symbol. Forward primer. Reverse primer. B2m. TTCTGGTGCTTGTCTCACTGA. CAGTATGTTCGGCTTCCCATT C. Ccl2. GCAGAGAGCCAGACGGG. ACAGCTTCTTTGGGACACCT. Feb 14, 2018 ... Are you taking mRNA sequence because you're doing reverse transcriptase PCR? How would do the same with genomic DNA, and if your forward ... Human U6 Forward Primer. Part Number: 600750. RUO Human U6 Forward Primer. For Research Use Only. Not for use in diagnostic procedures. Uses of synthetic primers. edit. Diagrammatic representation of the forward and reverse primers for a standard PCR. For the organic chemistry involved, see ... Jul 31, 2023 ... The primer anneals, or binds, to the DNA strand, facilitating its amplification. The forward primer matches the strand it binds to. The ... CAGACCTGCCTTACGACTATGG. Reversed primer. CTCGGTGGCGTTGAGATTGTT. Gpx. Forward primer. CCTTTTAAGCAGTATGCAGGCA. Reversed primer. CAAGCCAAATGGCCCAAGTT. Catalase. 16S V4 amplification primers · Ordering primers · 515F forward primer, barcoded · 806R reverse primer. Jun 27, 2013 ... Each forward and reverse primer will be provided in its own tube (meaning, a primer pair ... Human, Forward PCR primer, M13-tailed, HPLC. M13 ... Aug 31, 2022 ... LW043 Forward primer to amplify pBR-. lacI plasmid for Gibson cloning. GAATTCTCATGTTTGACAG. LW044 Reverse primer to amplify pBR-. lacI plasmid ... PUC/M13 (-40) Forward Primer / 17 mer (2 nmole). Universal primer for sequencing. * Formats: 2 nmole of lyophilized oligo in 1.5 ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.