Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What are microbiology studies?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ... Oct 4, 2020 ... This video is about how to design primers using Primer3Plus. Primer3Plus is an online tool which is used to design primers. To amplify any DNA sequence, two primers are necessary. One is called 'forward primer' and the other one is called 'reverse primer'. The forward primer ... Jul 31, 2023 ... The primer anneals, or binds, to the DNA strand, facilitating its amplification. The forward primer matches the strand it binds to. The ... ... 11, MYL6, forward primer, fragment 1, Bisulfite-PCR, ATTTTAAGCGTTTGAGTGTTGCAGGTAGGG. 12, MYL6, reverse primer, fragment 1, Bisulfite-PCR ... The forward primer attaches to the start codon of the template DNA (the anti-sense strand), while the reverse primer attaches to the stop codon of the ... Fusion primers contained either the A or B 454 amplicon adapter followed by a 5 nt multiplex identifier (MID; barcode) on the forward primer and ending with the ... Jan 13, 2016 ... ... forward primer driven PCR. ACTA BIOLOGICA SZEGEDIENSIS, 58 (1). pp. 65-68. ISSN 1588-385X. [img]. Preview. Text ActaBiolSzeged___2014___ ... Oct 17, 2023 ... 635022. (96 rxns). 12 µl. 12 µl. 12 µl. TCRa Human Primer 2 Reverse HT Index 1 (aR1; 12.5 μM). -. 12 µl. 12 µl. TCRa Human Primer 2 Reverse ... forward primer ATGACAATGAATACGGCTACAGCA . GAPDH reverse primer. GCAGCGAACTTTATTGATGGTATT forward primer. TGCAGAGGATGATTGCTGAC. Bax reverse primer.
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.