Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

Can multiple forward primers be used in a single PCR reaction?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

FAM Forward primer. HEX Reverse primer. FAM. HEX. Base pairs. Base pairs. Forward primer Genus specific probe. Reverse primer. Fig. 4. RFLP analysis of qPCR. Product description: Non-Variola Orthopoxvirus Forward Primer, 20 nmol, Add to favourites, Favourite: 20 nmol, Delivered amount: NVAR-OPXV-F-20. Product ... Dec 1, 2017 ... In the resulting fastq file, the sequences are multiplexed, the forward primer and reverse primer are still present, and the barcodes were ... pJET1.2 Forward Sequencing Primer, 23-mer. Catalog number:SO501. Share Copy product name Copy catalog number Copy catalog number and product name. Oct 25, 2019 ... AUG1 Forward, CAATTTACATCTTTATTTATTAACG For Pichia vectors with AUG1 promoter, forward primer ; AUG1 Reverse, GAAGAGAAAAACATTAGTTGGC For Pichia ... Mouse Siglec-G forward primer, 5'-GTCCCAGACTTGCATGAGAATC;. Mouse Siglec-G reverse primer, 5'-GACCCAGCTCAGTGTAGCA;. Mouse Klre1forward primer ... Catalog #. Primer. Sequence ; Sequencing Primers ; 26-3000-01. M13/pUC (-20); 17 mer. 5'-GTAAAACGACGGCCAGT-3' ; 26-3000-02. M13/pUC Reverse(-24); 16 mer. 5'- ... forward primer：CCTGCGCCTCAAGACCTTC. reverse primer：GTCACTGCGCTCCAGTAGAA. TGF-β1. forward primer：CCACCTGCAAGACCATCGAC. reverse primer：CTGGCGAGCCTTAGTTTGGAC. Human U6 Forward Primer. Part Number: 600750. RUO Human U6 Forward Primer. For Research Use Only. Not for use in diagnostic procedures. In the picture above, the forward primer anneals to the template (-) strand, and is identical to (a part of) the template (+) strand. And the reverse primer ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.