How does the forward primer function in cycle sequencing reactions?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Gene symbol. Forward primer. Reverse primer. B2m. TTCTGGTGCTTGTCTCACTGA. CAGTATGTTCGGCTTCCCATT C. Ccl2. GCAGAGAGCCAGACGGG. ACAGCTTCTTTGGGACACCT. Reverse primer. TCACCGCCTTGGCTTGTCAC. Rat beta-actin NM_031144.3. Forward primer CTAAGGCCAACCGTGAAAAGA. 99 bp. Reverse primer. CCAGAGGCATACAGGGACAAC. Human A2aR ... COX1. Forward Primer 5'-TCGGAGCCCCAGATATAGCA -3'. Reverse Primer. 5'-TTTCCGGCTAGAGGTGGGTA -3'. COX3. Forward Primer 5'-CAAGGCCACCACACTCCTAT -3'. To amplify any DNA sequence, two primers are necessary. One is called 'forward primer' and the other one is called 'reverse primer'. The forward primer ... Oct 21, 2021 ... For the reverse primer, however you've got to copy from the complementary strand. So you exchange Gs and Cs as well as A/T for each other in the ... Forward primer for CYP71ADH1-LP4/2A-. ADH1. 16 AGTAGCAACTTCGTCTGCTGCATTTGATCAAAACTTAATAAGGATTTTCACGCAGTCAGG. Reverse primer for CYP71ADH1-LP4/2A-. ADH1. 17 ... Supplemental table S1: Primer sequences. Gene symbol. Forward primer. Reverse primer. MR. GGACAATTCTTTCGTCGAATC. TTTTCTTCAAAAGAGCAGTGG. SGK1. Apr 3, 2014 ... ... forward primer and complementary sequences in reverse primer via a few bases. The method is different from current methods of nucleic ... Standard Primers. Sequence. Length ; T7 Promoter, 5'-TAA TAC GAC TCA CTA TAG GG-3', 20-mer ; T3 Promoter, 5'-CAA TTA ACC CTC ACT AAA GG-3', 20-mer ; M13 Forward (- ... User‐defined forward and reverse primers that are complementary upstream and downstream of the ... Amplicon PCR Forward Primer (Standard desalting). Amplicon PCR ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store
  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.