Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

How are forward primers used to study the expression or sequence of a gene?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ... The students block off the DNA sequences at the beginning of their gene for the forward primer and at the end of the gene for their reverse primer and add a ... Forward primer: 5´-GAATTGGAATATGCTAACTGCAACACC-3´. Reverse primer: 5´-GGTGTTGCAGTTAGCATATTCCAATTC-3´. N273A. Forward primer: 5´-TTGGAATATGGTGCCTGCAACACCAAG-3´. In the picture above, the forward primer anneals to the template (-) strand, and is identical to (a part of) the template (+) strand. And the reverse primer ... SDC, Table S1: Primers used for qRT-PCR. Housekeeping Gene. Forward Primer. Reverse Primer β-actin. '5-gacccagatcatgtttgagacc-3'. Mar 15, 2014 ... We used the pBS-gene as our template. We carried out four reactions, which are as followed: T7 (forward primer); T3 (reverse primer). S0540 - Forward and Reverse Control Primer Mix. Revision date 06-May-2023. SECTION 4: First aid measures. 4.1. Description of first aid measures. Inhalation. Aug 31, 2022 ... LW043 Forward primer to amplify pBR-. lacI plasmid for Gibson cloning. GAATTCTCATGTTTGACAG. LW044 Reverse primer to amplify pBR-. lacI plasmid ... List of qRT-PCR primers. Gene. Forward primer (5' - 3'). Reverse primer (5' - 3'). MMP11. CCGCAACCGACAGAAGAGG. ATCGCTCCATACCTTTAGGGC. GAPDH. Oct 29, 2015 ... || symbol can be used in the pattern matching step to include multiple primer sequences. Hope it helps! ADD ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.