How can consensus sequences inform the design of degenerate forward primers?

Name: How can consensus sequences inform the design of degenerate forward primers?
Brand: cauhoi2025.uk.com
Price: 29.99 USD
Availability: InStock
Rating: 4.51 (18008 reviews)

In Stock

Size Guide

Color

Size

Total :

~~$34.99~~ $29.99

Shipping and Returns Policy

Deliver to United States » Shipping Policy «
- Shipping Cost: $5.99
- Handling time: 2-3 business days
- Transit time: 7-10 business days
Eligible for » Returns & Refund Policy « within 30 days from the date of delivery

Jan 13, 2016 ... ... forward primer driven PCR. ACTA BIOLOGICA SZEGEDIENSIS, 58 (1). pp. 65-68. ISSN 1588-385X. [img]. Preview. Text ActaBiolSzeged___2014___ ... Forward primer for CYP71ADH1-LP4/2A-. ADH1. 16 AGTAGCAACTTCGTCTGCTGCATTTGATCAAAACTTAATAAGGATTTTCACGCAGTCAGG. Reverse primer for CYP71ADH1-LP4/2A-. ADH1. 17 ... Sequences of PCR primers (forward and reverse), primer position and PCR product sizes of bovine nucleic acid sequences used for investigating gene ... Sep 25, 2022 ... In this paper, we develop a semi-automated method to design both forward and reverse primer sets to detect SARS-CoV-2 variants. ... Table S1. RT-PCR primer sequences. Gene. Forward primer, 5' to 3'. Reverse primer, 5' to 3'. CYCLO. CAAATGCTGGACCAAACACA. CAGTCTTGGCGGTGCAGAT. NPC1L1. Feb 27, 2019 ... Diluting your 10μM solution in half will half the concentration. Mixing equal parts of 10μM primer will make a master mix where each primer is 5μM. ... forward primer, 1μl RP49 reverse primer, 0.5μl DNA polymerase, 36μl RNase-free H20) that was added to each tube. To test the eve primers, the same PCR mix ... Aug 31, 2022 ... LW043 Forward primer to amplify pBR-. lacI plasmid for Gibson cloning. GAATTCTCATGTTTGACAG. LW044 Reverse primer to amplify pBR-. lacI plasmid ... Supplemental table S1: Primer sequences. Gene symbol. Forward primer. Reverse primer. MR. GGACAATTCTTTCGTCGAATC. TTTTCTTCAAAAGAGCAGTGG. SGK1. 5' AGGCTGAGAACTCTCGCTTGC 3' Forward Primer. 5' GGTGCTGGTCCTCTGGTATCC 3' Reverse Primer. Murine Cxcl12. 5' CAGCCGTGCAACAATCTGAA 3' Forward Primer. 5 ...

Find similar items here:

what is forward primer

Next Day Delivery by USPS Find out more

Order by 9pm (excludes Public holidays)

$11.99
Express Delivery - 48 Hours Find out more

Order by 9pm (excludes Public holidays)

$9.99
Standard Delivery $6.99 Find out more

Delivered within 3 - 7 days (excludes Public holidays).
Store Delivery $6.99 Find out more

Delivered to your chosen store within 3-7 days

Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store
International Delivery Find out more

International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.