Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What are the latest advancements in RT-PCR technologies?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Forward primer: 5´-GAATTGGAATATGCTAACTGCAACACC-3´. Reverse primer: 5´-GGTGTTGCAGTTAGCATATTCCAATTC-3´. N273A. Forward primer: 5´-TTGGAATATGGTGCCTGCAACACCAAG-3´. Forward primer for CYP71ADH1-LP4/2A-. ADH1. 16 AGTAGCAACTTCGTCTGCTGCATTTGATCAAAACTTAATAAGGATTTTCACGCAGTCAGG. Reverse primer for CYP71ADH1-LP4/2A-. ADH1. 17 ... Reverse Complement converts a DNA sequence into its reverse, complement, or reverse-complement counterpart. You may want to work with the reverse-complement ... Jan 13, 2016 ... ... forward primer driven PCR. ACTA BIOLOGICA SZEGEDIENSIS, 58 (1). pp. 65-68. ISSN 1588-385X. [img]. Preview. Text ActaBiolSzeged___2014___ ... Gene symbol. Forward primer. Reverse primer. B2m. TTCTGGTGCTTGTCTCACTGA. CAGTATGTTCGGCTTCCCATT C. Ccl2. GCAGAGAGCCAGACGGG. ACAGCTTCTTTGGGACACCT. ... 11, MYL6, forward primer, fragment 1, Bisulfite-PCR, ATTTTAAGCGTTTGAGTGTTGCAGGTAGGG. 12, MYL6, reverse primer, fragment 1, Bisulfite-PCR ... forward primer ATGACAATGAATACGGCTACAGCA . GAPDH reverse primer. GCAGCGAACTTTATTGATGGTATT forward primer. TGCAGAGGATGATTGCTGAC. Bax reverse primer. 3' primer (reverse primer) should align to the last 18-20 nucleotides of the anti-sense strand (complement to antisense strand). Make sure a stop codon (TAA ( ... Dec 1, 2017 ... In the resulting fastq file, the sequences are multiplexed, the forward primer and reverse primer are still present, and the barcodes were ... Primer-BLAST to better identify the template and thus perform better primer specificity checking. A template is not required if both forward and reverse ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.