Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

Can forward primers be designed to target specific regions on a chromosome?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Target - If available, choose to query transcribed sequences. Forward Primer - Must be at least 15 bases in length. Reverse Primer - On the opposite strand from ... Sequences of PCR primers (forward and reverse), primer position and PCR product sizes of bovine nucleic acid sequences used for investigating gene ... PUC/M13 (-40) Forward Primer / 17 mer (2 nmole). Universal primer for sequencing. * Formats: 2 nmole of lyophilized oligo in 1.5 ... User‐defined forward and reverse primers that are complementary upstream and downstream of the ... Amplicon PCR Forward Primer (Standard desalting). Amplicon PCR ... Standard Primers. Sequence. Length ; T7 Promoter, 5'-TAA TAC GAC TCA CTA TAG GG-3', 20-mer ; T3 Promoter, 5'-CAA TTA ACC CTC ACT AAA GG-3', 20-mer ; M13 Forward (- ... Forward primer (5'→3'). Reverse primer (5'→3'). Murine. MMP-3. TGAAAATGAAGGGTCTTCCGG. GCAGAAGCTCCATACCAGCA. MMP-13. GATGGCACTGCTGACATCAT. TGTAGCCTTTGGAACTGCTT. Forward primer for CYP71ADH1-LP4/2A-. ADH1. 16 AGTAGCAACTTCGTCTGCTGCATTTGATCAAAACTTAATAAGGATTTTCACGCAGTCAGG. Reverse primer for CYP71ADH1-LP4/2A-. ADH1. 17 ... Reverse Complement converts a DNA sequence into its reverse, complement, or reverse-complement counterpart. You may want to work with the reverse-complement ... Reverse primer. TCACCGCCTTGGCTTGTCAC. Rat beta-actin NM_031144.3. Forward primer CTAAGGCCAACCGTGAAAAGA. 99 bp. Reverse primer. CCAGAGGCATACAGGGACAAC. Human A2aR ... Dec 1, 2017 ... In the resulting fastq file, the sequences are multiplexed, the forward primer and reverse primer are still present, and the barcodes were ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.