What are metagenomics studies?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Table 1Primer sequences used for RT-qPCR.a Table 1 GENE FORWARD PRIMER (5′–3′) REVERSE PRIMER (5′–3′) Col2a1 GCTGGTGAAGAAGGCAAACGAG CCATCTTGACCTGGGAATCCAC S. Having trouble accessing something on this page? Please send us an email and we will get back to you as quickly as we can. Banking · Research · Events ... ... forward and reverse primer? Do you get the same number? Determine the type of DNA sequence amplified by the primer set: Click the accession link (beginning ... Jan 5, 2023 ... ... forward primer (10 μM), 1.0 μL reverse primer (10 μM), 0.3 μL exo probe (10 μM), 4.75 μL nuclease-free water, 2.0 μL nucleic acid template ... PrimerHunter searches for forward and reverse primers that ... When a forward primer is specified, PrimerHunter applies every filter to this primer ... ... forward primer, 1μl RP49 reverse primer, 0.5μl DNA polymerase, 36μl RNase-free H20) that was added to each tube. To test the eve primers, the same PCR mix ... GFP, H1-GFP, T-L7, T-L22 in pIB/V5-His-TOPO vector. GFP. Forward primer 5'- ACCATGGCTAGCAAAGGAGAAGAA -3'. Reverse primer 5'- TTATTTGTAGAGCTCATCCATG -3'. FAM Forward primer. HEX Reverse primer. FAM. HEX. Base pairs. Base pairs. Forward primer Genus specific probe. Reverse primer. Fig. 4. RFLP analysis of qPCR. Sep 25, 2022 ... In this paper, we develop a semi-automated method to design both forward and reverse primer sets to detect SARS-CoV-2 variants. Supplemental table S1: Primer sequences. Gene symbol. Forward primer. Reverse primer. MR. GGACAATTCTTTCGTCGAATC. TTTTCTTCAAAAGAGCAGTGG. SGK1.
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store
  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.