What are the different strategies for RNA-Seq library construction?

The design tool analyses the entered DNA sequence and chooses the optimum forward or reverse sequencing primers. GFP, H1-GFP, T-L7, T-L22 in pIB/V5-His-TOPO vector. GFP. Forward primer 5'- ACCATGGCTAGCAAAGGAGAAGAA -3'. Reverse primer 5'- TTATTTGTAGAGCTCATCCATG -3'. COX1. Forward Primer 5'-TCGGAGCCCCAGATATAGCA -3'. Reverse Primer. 5'-TTTCCGGCTAGAGGTGGGTA -3'. COX3. Forward Primer 5'-CAAGGCCACCACACTCCTAT -3'. FAM Forward primer. HEX Reverse primer. FAM. HEX. Base pairs. Base pairs. Forward primer Genus specific probe. Reverse primer. Fig. 4. RFLP analysis of qPCR. or a Primer Pair with forward and reverse primers in separate tubes for PCR and Sanger sequencing. Suitable for 200-500 rxns depending on usage. Format *. Mouse Siglec-G forward primer, 5'-GTCCCAGACTTGCATGAGAATC;. Mouse Siglec-G reverse primer, 5'-GACCCAGCTCAGTGTAGCA;. Mouse Klre1forward primer ... Feb 27, 2019 ... Diluting your 10μM solution in half will half the concentration. Mixing equal parts of 10μM primer will make a master mix where each primer is 5μM. Feb 15, 2022 ... GAGTACT ATGAGT ATAGTC Асстс А GA А CTCA Forward Primer: Reverse Primer: Answer 1: You Answered (You left this blank) Correct Answer CAGATCCATGG ... To amplify any DNA sequence, two primers are necessary. One is called 'forward primer' and the other one is called 'reverse primer'. The forward primer ... Apr 3, 2014 ... ... forward primer and complementary sequences in reverse primer via a few bases. The method is different from current methods of nucleic ...