What is non-specific binding of primers?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

5' AGGCTGAGAACTCTCGCTTGC 3' Forward Primer. 5' GGTGCTGGTCCTCTGGTATCC 3' Reverse Primer. Murine Cxcl12. 5' CAGCCGTGCAACAATCTGAA 3' Forward Primer. 5 ... ... forward primer, 1μl RP49 reverse primer, 0.5μl DNA polymerase, 36μl RNase-free H20) that was added to each tube. To test the eve primers, the same PCR mix ... Significant values (*P < 0.05) are indicated nt = nucleotide, rev = reverse primer, fwd = forward primer. To study the impact of a specific mismatch type on PCR ... Feb 15, 2022 ... GAGTACT ATGAGT ATAGTC Асстс А GA А CTCA Forward Primer: Reverse Primer: Answer 1: You Answered (You left this blank) Correct Answer CAGATCCATGG ... PCR Amplification. The primer pairs we use for the PCR amplification of internal fragments of these genes are: Gene, Forward primer 5'-3' sequence, Reverse ... Apr 3, 2014 ... ... forward primer and complementary sequences in reverse primer via a few bases. The method is different from current methods of nucleic ... List of qRT-PCR primers. Gene. Forward primer (5' - 3'). Reverse primer (5' - 3'). MMP11. CCGCAACCGACAGAAGAGG. ATCGCTCCATACCTTTAGGGC. GAPDH. Human U6 Forward Primer. Part Number: 600750. RUO Human U6 Forward Primer. For Research Use Only. Not for use in diagnostic procedures. Standard Primers. Sequence. Length ; T7 Promoter, 5'-TAA TAC GAC TCA CTA TAG GG-3', 20-mer ; T3 Promoter, 5'-CAA TTA ACC CTC ACT AAA GG-3', 20-mer ; M13 Forward (- ... User‐defined forward and reverse primers that are complementary upstream and downstream of the ... Amplicon PCR Forward Primer (Standard desalting). Amplicon PCR ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store
  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.