Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What are the benefits of using LNA-modified forward primers?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Primer Sequences. Gene. COLIAI. COL2A1. GATTCCCTGGACCTAAAGGTGC. CCTGGCAAAGATGGTGAGACAG. COL3A1 ... Forward (5'-3'). Reverse (3'-5'). AGCCTCTCCATCTTTGCCAGCA. Shop Applied Biosystems™ Human, Forward Primer, Desalted at Fishersci.com. May 5, 2022 ... Barcoded forward primer mix added across the rows A—H. Add the reverse 16S rRNA barcoded primer down the column of the 96-well PCR plate as ... User‐defined forward and reverse primers that are complementary upstream and downstream of the ... Amplicon PCR Forward Primer (Standard desalting). Amplicon PCR ... Mar 15, 2014 ... We used the pBS-gene as our template. We carried out four reactions, which are as followed: T7 (forward primer); T3 (reverse primer). Catalog #. Primer. Sequence ; Sequencing Primers ; 26-3000-01. M13/pUC (-20); 17 mer. 5'-GTAAAACGACGGCCAGT-3' ; 26-3000-02. M13/pUC Reverse(-24); 16 mer. 5'- ... Mouse Siglec-G forward primer, 5'-GTCCCAGACTTGCATGAGAATC;. Mouse Siglec-G reverse primer, 5'-GACCCAGCTCAGTGTAGCA;. Mouse Klre1forward primer ... Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study. Gene symbol. Forward primer. Reverse primer. B2m. TTCTGGTGCTTGTCTCACTGA. CAGTATGTTCGGCTTCCCATT C. Ccl2. GCAGAGAGCCAGACGGG. ACAGCTTCTTTGGGACACCT. Feb 15, 2022 ... GAGTACT ATGAGT ATAGTC Асстс А GA А CTCA Forward Primer: Reverse Primer: Answer 1: You Answered (You left this blank) Correct Answer CAGATCCATGG ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.