Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What is exome sequencing?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Oct 17, 2023 ... 635022. (96 rxns). 12 µl. 12 µl. 12 µl. TCRa Human Primer 2 Reverse HT Index 1 (aR1; 12.5 μM). -. 12 µl. 12 µl. TCRa Human Primer 2 Reverse ... forward primer ATGACAATGAATACGGCTACAGCA . GAPDH reverse primer. GCAGCGAACTTTATTGATGGTATT forward primer. TGCAGAGGATGATTGCTGAC. Bax reverse primer. Universal 3' miRNA Reverse Primer. Cat. No. MPH00000. Unit 150 μl / 10 μM. Price $20.00. Add to Cart. Sequencing of BioBrick parts ; BBa_G00401, Reverse Primer to C0040, gcggacccactttcacatttaag, R ; BBa_G00700, Forward primer for I0500 (pBAD), agatttatcgccagcagctc ... Reverse Complement converts a DNA sequence into its reverse, complement, or reverse-complement counterpart. You may want to work with the reverse-complement ... Jan 13, 2016 ... ... forward primer driven PCR. ACTA BIOLOGICA SZEGEDIENSIS, 58 (1). pp. 65-68. ISSN 1588-385X. [img]. Preview. Text ActaBiolSzeged___2014___ ... Catalog #. Primer. Sequence ; Sequencing Primers ; 26-3000-01. M13/pUC (-20); 17 mer. 5'-GTAAAACGACGGCCAGT-3' ; 26-3000-02. M13/pUC Reverse(-24); 16 mer. 5'- ... Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below). ... pBAD Forward. 20. Jun 27, 2013 ... Each forward and reverse primer will be provided in its own tube (meaning, a primer pair ... Human, Forward PCR primer, M13-tailed, HPLC. M13 ... Sep 25, 2022 ... In this paper, we develop a semi-automated method to design both forward and reverse primer sets to detect SARS-CoV-2 variants.
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.