Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What are population genetics studies?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Primer Sequences. Gene. COLIAI. COL2A1. GATTCCCTGGACCTAAAGGTGC. CCTGGCAAAGATGGTGAGACAG. COL3A1 ... Forward (5'-3'). Reverse (3'-5'). AGCCTCTCCATCTTTGCCAGCA. Jan 5, 2023 ... ... forward primer (10 μM), 1.0 μL reverse primer (10 μM), 0.3 μL exo probe (10 μM), 4.75 μL nuclease-free water, 2.0 μL nucleic acid template ... TK. Forward primer (gE592F): CCGCGGGCCGTGTTCTTTGT. 568. gH. Reverse primer (gE1084R): CGTGGCCGTTGTGGGTCAT. 634. gL. Forward primer (gE1066F): ... COX1. Forward Primer 5'-TCGGAGCCCCAGATATAGCA -3'. Reverse Primer. 5'-TTTCCGGCTAGAGGTGGGTA -3'. COX3. Forward Primer 5'-CAAGGCCACCACACTCCTAT -3'. List of qRT-PCR primers. Gene. Forward primer (5' - 3'). Reverse primer (5' - 3'). MMP11. CCGCAACCGACAGAAGAGG. ATCGCTCCATACCTTTAGGGC. GAPDH. ... forward and reverse primer? Do you get the same number? Determine the type of DNA sequence amplified by the primer set: Click the accession link (beginning ... Significant values (*P < 0.05) are indicated nt = nucleotide, rev = reverse primer, fwd = forward primer. To study the impact of a specific mismatch type on PCR ... Dec 1, 2017 ... In the resulting fastq file, the sequences are multiplexed, the forward primer and reverse primer are still present, and the barcodes were ... Sep 25, 2022 ... In this paper, we develop a semi-automated method to design both forward and reverse primer sets to detect SARS-CoV-2 variants. Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.