Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What are the design strategies for multiplex PCR assays with multiple forward primers?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

S0540 - Forward and Reverse Control Primer Mix. Revision date 06-May-2023. SECTION 4: First aid measures. 4.1. Description of first aid measures. Inhalation. Forward primer: 5´-GAATTGGAATATGCTAACTGCAACACC-3´. Reverse primer: 5´-GGTGTTGCAGTTAGCATATTCCAATTC-3´. N273A. Forward primer: 5´-TTGGAATATGGTGCCTGCAACACCAAG-3´. ... forward primer, and reverse primer. MOL9069. Copy to clipboard. 25 µL. BKV PRIMER PAIR. For amplification and detection of the 5′ region of the VP2 gene with a ... Significant values (*P < 0.05) are indicated nt = nucleotide, rev = reverse primer, fwd = forward primer. To study the impact of a specific mismatch type on PCR ... Feb 15, 2022 ... GAGTACT ATGAGT ATAGTC Асстс А GA А CTCA Forward Primer: Reverse Primer: Answer 1: You Answered (You left this blank) Correct Answer CAGATCCATGG ... Reverse primer. TCACCGCCTTGGCTTGTCAC. Rat beta-actin NM_031144.3. Forward primer CTAAGGCCAACCGTGAAAAGA. 99 bp. Reverse primer. CCAGAGGCATACAGGGACAAC. Human A2aR ... ... 11, MYL6, forward primer, fragment 1, Bisulfite-PCR, ATTTTAAGCGTTTGAGTGTTGCAGGTAGGG. 12, MYL6, reverse primer, fragment 1, Bisulfite-PCR ... TK. Forward primer (gE592F): CCGCGGGCCGTGTTCTTTGT. 568. gH. Reverse primer (gE1084R): CGTGGCCGTTGTGGGTCAT. 634. gL. Forward primer (gE1066F): ... BGH-Reverse. TAGAAGGCACAGTCGAGG. BGH (bovine growth hormone) terminator, reverse primer. CMV-F. CGCAAATGGGCGGTAGGCGTG. CMV promoter, forward primer. Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.