Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What are animal biotechnology applications of PCR?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Sep 1, 2018 ... They twist together in a double-stranded configuration, but when you heat them enough (usually about 94–95 degrees C), the bonds break and they come unstuck. GFP, H1-GFP, T-L7, T-L22 in pIB/V5-His-TOPO vector. GFP. Forward primer 5'- ACCATGGCTAGCAAAGGAGAAGAA -3'. Reverse primer 5'- TTATTTGTAGAGCTCATCCATG -3'. Universal 3' miRNA Reverse Primer. Cat. No. MPH00000. Unit 150 μl / 10 μM. Price $20.00. Add to Cart. FAM Forward primer. HEX Reverse primer. FAM. HEX. Base pairs. Base pairs. Forward primer Genus specific probe. Reverse primer. Fig. 4. RFLP analysis of qPCR. User‐defined forward and reverse primers that are complementary upstream and downstream of the ... Amplicon PCR Forward Primer (Standard desalting). Amplicon PCR ... 3' primer (reverse primer) should align to the last 18-20 nucleotides of the anti-sense strand (complement to antisense strand). Make sure a stop codon (TAA ( ... Jan 13, 2016 ... ... forward primer driven PCR. ACTA BIOLOGICA SZEGEDIENSIS, 58 (1). pp. 65-68. ISSN 1588-385X. [img]. Preview. Text ActaBiolSzeged___2014___ ... Oct 25, 2019 ... AUG1 Forward, CAATTTACATCTTTATTTATTAACG For Pichia vectors with AUG1 promoter, forward primer ; AUG1 Reverse, GAAGAGAAAAACATTAGTTGGC For Pichia ... Primer sequences for relative genes. Gene. Forward primer. Reverse primer. hGAPDH. AGGGCTGCTTTTAACTCTGGT. CCCCACTTGATTTTGGAGGGA. hPDL1. TGGCATTTGCTGAACGCATTT. ... forward primer, and reverse primer. MOL9069. Copy to clipboard. 25 µL. BKV PRIMER PAIR. For amplification and detection of the 5′ region of the VP2 gene with a ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.