What are antibody-based detection methods (e.g., ELISA, Western blot)?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Gene symbol. Forward primer. Reverse primer. B2m. TTCTGGTGCTTGTCTCACTGA. CAGTATGTTCGGCTTCCCATT C. Ccl2. GCAGAGAGCCAGACGGG. ACAGCTTCTTTGGGACACCT. Nov 5, 2014 ... Forward Primer: 4. Reverse Primer: 6. (self-complementary). Forward: 2. Reverse: 2. (3' self complementary). Cite · Elizabeth Reynaga. Results of sequencing show that the products of SDAMP amplification are mainly polymers formed by series connection of monomers formed through linkage of ... Product description: Non-Variola Orthopoxvirus Forward Primer, 20 nmol, Add to favourites, Favourite: 20 nmol, Delivered amount: NVAR-OPXV-F-20. Product ... Because primers are read and created by humans our reverse primer need to be written from the beginning to the end. This is called the “reverse complement” of ... The forward primer attaches to the start codon of the template DNA (the anti-sense strand), while the reverse primer attaches to the stop codon of the ... Oct 29, 2015 ... || symbol can be used in the pattern matching step to include multiple primer sequences. Hope it helps! ADD ... Feb 27, 2019 ... Diluting your 10μM solution in half will half the concentration. Mixing equal parts of 10μM primer will make a master mix where each primer is 5μM. Human U6 Forward Primer. Part Number: 600750. RUO Human U6 Forward Primer. For Research Use Only. Not for use in diagnostic procedures. User‐defined forward and reverse primers that are complementary upstream and downstream of the ... Amplicon PCR Forward Primer (Standard desalting). Amplicon PCR ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store
  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.