Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

How are forward primers used in PCR performed directly on cells or tissues?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

16S V4 amplification primers · Ordering primers · 515F forward primer, barcoded · 806R reverse primer. Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ... Product description: Non-Variola Orthopoxvirus Forward Primer, 20 nmol, Add to favourites, Favourite: 20 nmol, Delivered amount: NVAR-OPXV-F-20. Product ... Reverse primer. TCACCGCCTTGGCTTGTCAC. Rat beta-actin NM_031144.3. Forward primer CTAAGGCCAACCGTGAAAAGA. 99 bp. Reverse primer. CCAGAGGCATACAGGGACAAC. Human A2aR ... Primer sequences for relative genes. Gene. Forward primer. Reverse primer. hGAPDH. AGGGCTGCTTTTAACTCTGGT. CCCCACTTGATTTTGGAGGGA. hPDL1. TGGCATTTGCTGAACGCATTT. Nov 5, 2014 ... Forward Primer: 4. Reverse Primer: 6. (self-complementary). Forward: 2. Reverse: 2. (3' self complementary). Cite · Elizabeth Reynaga. PrimerHunter searches for forward and reverse primers that ... When a forward primer is specified, PrimerHunter applies every filter to this primer ... Supplemental table S1: Primer sequences. Gene symbol. Forward primer. Reverse primer. MR. GGACAATTCTTTCGTCGAATC. TTTTCTTCAAAAGAGCAGTGG. SGK1. Oct 25, 2019 ... AUG1 Forward, CAATTTACATCTTTATTTATTAACG For Pichia vectors with AUG1 promoter, forward primer ; AUG1 Reverse, GAAGAGAAAAACATTAGTTGGC For Pichia ... ... forward primer, and reverse primer. MOL9069. Copy to clipboard. 25 µL. BKV PRIMER PAIR. For amplification and detection of the 5′ region of the VP2 gene with a ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.