How can these databases be used to design or analyze forward primers?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

PrimerHunter searches for forward and reverse primers that ... When a forward primer is specified, PrimerHunter applies every filter to this primer ... Having trouble accessing something on this page? Please send us an email and we will get back to you as quickly as we can. Banking · Research · Events ... 16S V4 amplification primers · Ordering primers · 515F forward primer, barcoded · 806R reverse primer. Mar 4, 2022 ... The Forward-Looking Analysis of Risk Events (FLARE) model is one such tool. This technical note describes the FLARE model, which is a top-down ... Full Primer List ; CAT-R · GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer ; CMV Forward, CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human ... FEC is an effective digital signal processing method that improves the bit error rate of communication links by adding redundant information (parity bits) to ... Nov 5, 2014 ... Forward Primer: 4. Reverse Primer: 6. (self-complementary). Forward: 2. Reverse: 2. (3' self complementary). Cite · Elizabeth Reynaga. forward primer:CCTGCGCCTCAAGACCTTC. reverse primer:GTCACTGCGCTCCAGTAGAA. TGF-β1. forward primer:CCACCTGCAAGACCATCGAC. reverse primer:CTGGCGAGCCTTAGTTTGGAC. Sep 1, 2018 ... They twist together in a double-stranded configuration, but when you heat them enough (usually about 94–95 degrees C), the bonds break and they come unstuck. Target - If available, choose to query transcribed sequences. Forward Primer - Must be at least 15 bases in length. Reverse Primer - On the opposite strand from ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store
  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.