Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

How can the design of the forward primer minimize non-specific binding?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

BGH-Reverse. TAGAAGGCACAGTCGAGG. BGH (bovine growth hormone) terminator, reverse primer. CMV-F. CGCAAATGGGCGGTAGGCGTG. CMV promoter, forward primer. CAGACCTGCCTTACGACTATGG. Reversed primer. CTCGGTGGCGTTGAGATTGTT. Gpx. Forward primer. CCTTTTAAGCAGTATGCAGGCA. Reversed primer. CAAGCCAAATGGCCCAAGTT. Catalase. Universal 3' miRNA Reverse Primer. Cat. No. MPH00000. Unit 150 μl / 10 μM. Price $20.00. Add to Cart. Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ... Jan 5, 2023 ... ... forward primer (10 μM), 1.0 μL reverse primer (10 μM), 0.3 μL exo probe (10 μM), 4.75 μL nuclease-free water, 2.0 μL nucleic acid template ... TK. Forward primer (gE592F): CCGCGGGCCGTGTTCTTTGT. 568. gH. Reverse primer (gE1084R): CGTGGCCGTTGTGGGTCAT. 634. gL. Forward primer (gE1066F): ... In the picture above, the forward primer anneals to the template (-) strand, and is identical to (a part of) the template (+) strand. And the reverse primer ... Nov 5, 2014 ... Forward Primer: 4. Reverse Primer: 6. (self-complementary). Forward: 2. Reverse: 2. (3' self complementary). Cite · Elizabeth Reynaga. Forward primer for CYP71ADH1-LP4/2A-. ADH1. 16 AGTAGCAACTTCGTCTGCTGCATTTGATCAAAACTTAATAAGGATTTTCACGCAGTCAGG. Reverse primer for CYP71ADH1-LP4/2A-. ADH1. 17 ... 5' AGGCTGAGAACTCTCGCTTGC 3' Forward Primer. 5' GGTGCTGGTCCTCTGGTATCC 3' Reverse Primer. Murine Cxcl12. 5' CAGCCGTGCAACAATCTGAA 3' Forward Primer. 5 ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.