How can problems related to forward or reverse primers be identified and resolved?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Aug 31, 2022 ... LW043 Forward primer to amplify pBR-. lacI plasmid for Gibson cloning. GAATTCTCATGTTTGACAG. LW044 Reverse primer to amplify pBR-. lacI plasmid ... CAGACCTGCCTTACGACTATGG. Reversed primer. CTCGGTGGCGTTGAGATTGTT. Gpx. Forward primer. CCTTTTAAGCAGTATGCAGGCA. Reversed primer. CAAGCCAAATGGCCCAAGTT. Catalase. PrimerHunter searches for forward and reverse primers that ... When a forward primer is specified, PrimerHunter applies every filter to this primer ... Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ... Product description: Non-Variola Orthopoxvirus Forward Primer, 20 nmol, Add to favourites, Favourite: 20 nmol, Delivered amount: NVAR-OPXV-F-20. Product ... ... 11, MYL6, forward primer, fragment 1, Bisulfite-PCR, ATTTTAAGCGTTTGAGTGTTGCAGGTAGGG. 12, MYL6, reverse primer, fragment 1, Bisulfite-PCR ... Forward Primer is a DNA stretch that attaches to the antisense strand (-) of the DNA that runs in 3' to 5' direction. The primers anneal to the DNA strand and ... Oct 21, 2021 ... For the reverse primer, however you've got to copy from the complementary strand. So you exchange Gs and Cs as well as A/T for each other in the ... Oct 24, 2019 ... Your FWD primer is found on the reverse reads in its forward orientation. So... treat that as the reverse complement of the REV primer in the tutorial. Table 1Primer sequences used for RT-qPCR.a Table 1 GENE FORWARD PRIMER (5′–3′) REVERSE PRIMER (5′–3′) Col2a1 GCTGGTGAAGAAGGCAAACGAG CCATCTTGACCTGGGAATCCAC S.
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store
  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.