How are forward primers designed to amplify housekeeping genes as controls?

... Table S1. RT-PCR primer sequences. Gene. Forward primer, 5' to 3'. Reverse primer, 5' to 3'. CYCLO. CAAATGCTGGACCAAACACA. CAGTCTTGGCGGTGCAGAT. NPC1L1. Oct 25, 2019 ... AUG1 Forward, CAATTTACATCTTTATTTATTAACG For Pichia vectors with AUG1 promoter, forward primer ; AUG1 Reverse, GAAGAGAAAAACATTAGTTGGC For Pichia ... QuantiMir™ 3' Universal Primer. Keep your QuantiMir studies moving forward with additional universal 3' reverse primer. BGH-Reverse. TAGAAGGCACAGTCGAGG. BGH (bovine growth hormone) terminator, reverse primer. CMV-F. CGCAAATGGGCGGTAGGCGTG. CMV promoter, forward primer. PrimerHunter searches for forward and reverse primers that ... When a forward primer is specified, PrimerHunter applies every filter to this primer ... Aug 3, 2009 ... The forward primer was sited in the pol gene at a position ... forward and reverse CAS pol primers, and these are likely to prevent amplification. ... 11, MYL6, forward primer, fragment 1, Bisulfite-PCR, ATTTTAAGCGTTTGAGTGTTGCAGGTAGGG. 12, MYL6, reverse primer, fragment 1, Bisulfite-PCR ... Oct 21, 2021 ... For the reverse primer, however you've got to copy from the complementary strand. So you exchange Gs and Cs as well as A/T for each other in the ... Jan 5, 2023 ... ... forward primer (10 μM), 1.0 μL reverse primer (10 μM), 0.3 μL exo probe (10 μM), 4.75 μL nuclease-free water, 2.0 μL nucleic acid template ... Results of sequencing show that the products of SDAMP amplification are mainly polymers formed by series connection of monomers formed through linkage of ...