Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What is loop-mediated isothermal amplification (LAMP)?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

5' AGGCTGAGAACTCTCGCTTGC 3' Forward Primer. 5' GGTGCTGGTCCTCTGGTATCC 3' Reverse Primer. Murine Cxcl12. 5' CAGCCGTGCAACAATCTGAA 3' Forward Primer. 5 ... Nov 5, 2014 ... Forward Primer: 4. Reverse Primer: 6. (self-complementary). Forward: 2. Reverse: 2. (3' self complementary). Cite · Elizabeth Reynaga. Primer Sequences. Gene. COLIAI. COL2A1. GATTCCCTGGACCTAAAGGTGC. CCTGGCAAAGATGGTGAGACAG. COL3A1 ... Forward (5'-3'). Reverse (3'-5'). AGCCTCTCCATCTTTGCCAGCA. May 12, 2023 ... Reverse Primer · Reverse primers are DNA segments that are complementary to the sense strand of the double-stranded DNA. · They are also known ... the template, and the first fragment's forward primer and the second fragment's reverse primer. were used as the new primer set. The second-round PCR product ... Supplemental table S1: Primer sequences. Gene symbol. Forward primer. Reverse primer. MR. GGACAATTCTTTCGTCGAATC. TTTTCTTCAAAAGAGCAGTGG. SGK1. Jan 9, 2024 ... We developed a simple, accurate and economical approach to genotyping of rs12041331 (PEAR1), rs6065 (GP1BA) and rs730012 (LTC4S) to provide a valuable ... pJET1.2 Forward Sequencing Primer, 23-mer. Catalog number:SO501. Share Copy product name Copy catalog number Copy catalog number and product name. Gene symbol. Forward primer. Reverse primer. B2m. TTCTGGTGCTTGTCTCACTGA. CAGTATGTTCGGCTTCCCATT C. Ccl2. GCAGAGAGCCAGACGGG. ACAGCTTCTTTGGGACACCT. Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below). ... pBAD Forward. 20.
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.