Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What are the different types of oligo(dT) primers used for reverse transcription?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

PrimerHunter searches for forward and reverse primers that ... When a forward primer is specified, PrimerHunter applies every filter to this primer ... PUC/M13 (-40) Forward Primer / 17 mer (2 nmole). Universal primer for sequencing. * Formats: 2 nmole of lyophilized oligo in 1.5 ... Oct 25, 2019 ... AUG1 Forward, CAATTTACATCTTTATTTATTAACG For Pichia vectors with AUG1 promoter, forward primer ; AUG1 Reverse, GAAGAGAAAAACATTAGTTGGC For Pichia ... RNase P Forward Primer Aliquot, 100 nmol, 10006836 ; RNase P Reverse Primer Aliquot, 100 nmol, 10006837 ... SDC, Table S1: Primers used for qRT-PCR. Housekeeping Gene. Forward Primer. Reverse Primer β-actin. '5-gacccagatcatgtttgagacc-3'. Oct 17, 2023 ... 635022. (96 rxns). 12 µl. 12 µl. 12 µl. TCRa Human Primer 2 Reverse HT Index 1 (aR1; 12.5 μM). -. 12 µl. 12 µl. TCRa Human Primer 2 Reverse ... Supplemental table S1: Primer sequences. Gene symbol. Forward primer. Reverse primer. MR. GGACAATTCTTTCGTCGAATC. TTTTCTTCAAAAGAGCAGTGG. SGK1. Primer sequences for relative genes. Gene. Forward primer. Reverse primer. hGAPDH. AGGGCTGCTTTTAACTCTGGT. CCCCACTTGATTTTGGAGGGA. hPDL1. TGGCATTTGCTGAACGCATTT. Universal 3' miRNA Reverse Primer. Cat. No. MPH00000. Unit 150 μl / 10 μM. Price $20.00. Add to Cart. 5' AGGCTGAGAACTCTCGCTTGC 3' Forward Primer. 5' GGTGCTGGTCCTCTGGTATCC 3' Reverse Primer. Murine Cxcl12. 5' CAGCCGTGCAACAATCTGAA 3' Forward Primer. 5 ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.