Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What are TaqMan probes?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

S0540 - Forward and Reverse Control Primer Mix. Revision date 06-May-2023. SECTION 4: First aid measures. 4.1. Description of first aid measures. Inhalation. Jan 9, 2024 ... We developed a simple, accurate and economical approach to genotyping of rs12041331 (PEAR1), rs6065 (GP1BA) and rs730012 (LTC4S) to provide a valuable ... 5' AGGCTGAGAACTCTCGCTTGC 3' Forward Primer. 5' GGTGCTGGTCCTCTGGTATCC 3' Reverse Primer. Murine Cxcl12. 5' CAGCCGTGCAACAATCTGAA 3' Forward Primer. 5 ... May 12, 2023 ... Reverse Primer · Reverse primers are DNA segments that are complementary to the sense strand of the double-stranded DNA. · They are also known ... pJET1.2 Forward Sequencing Primer, 23-mer. Catalog number:SO501. Share Copy product name Copy catalog number Copy catalog number and product name. 3' primer (reverse primer) should align to the last 18-20 nucleotides of the anti-sense strand (complement to antisense strand). Make sure a stop codon (TAA ( ... Gene symbol. Forward primer. Reverse primer. B2m. TTCTGGTGCTTGTCTCACTGA. CAGTATGTTCGGCTTCCCATT C. Ccl2. GCAGAGAGCCAGACGGG. ACAGCTTCTTTGGGACACCT. GFP, H1-GFP, T-L7, T-L22 in pIB/V5-His-TOPO vector. GFP. Forward primer 5'- ACCATGGCTAGCAAAGGAGAAGAA -3'. Reverse primer 5'- TTATTTGTAGAGCTCATCCATG -3'. Results of sequencing show that the products of SDAMP amplification are mainly polymers formed by series connection of monomers formed through linkage of ... Fusion primers contained either the A or B 454 amplicon adapter followed by a 5 nt multiplex identifier (MID; barcode) on the forward primer and ending with the ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.