Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

What are food safety testing using PCR?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below). ... pBAD Forward. 20. Gene symbol. Forward primer. Reverse primer. B2m. TTCTGGTGCTTGTCTCACTGA. CAGTATGTTCGGCTTCCCATT C. Ccl2. GCAGAGAGCCAGACGGG. ACAGCTTCTTTGGGACACCT. Forward primer: 5´-GAATTGGAATATGCTAACTGCAACACC-3´. Reverse primer: 5´-GGTGTTGCAGTTAGCATATTCCAATTC-3´. N273A. Forward primer: 5´-TTGGAATATGGTGCCTGCAACACCAAG-3´. ... forward primer, and reverse primer. MOL9069. Copy to clipboard. 25 µL. BKV PRIMER PAIR. For amplification and detection of the 5′ region of the VP2 gene with a ... BGH-Reverse. TAGAAGGCACAGTCGAGG. BGH (bovine growth hormone) terminator, reverse primer. CMV-F. CGCAAATGGGCGGTAGGCGTG. CMV promoter, forward primer. Table SII. Minor allele frequencies of single nucleotide polymorphisms rs799917 and rs2231142 in different populations. Population rs799917 (n). Oct 17, 2023 ... 635022. (96 rxns). 12 µl. 12 µl. 12 µl. TCRa Human Primer 2 Reverse HT Index 1 (aR1; 12.5 μM). -. 12 µl. 12 µl. TCRa Human Primer 2 Reverse ... To amplify any DNA sequence, two primers are necessary. One is called 'forward primer' and the other one is called 'reverse primer'. The forward primer ... Having trouble accessing something on this page? Please send us an email and we will get back to you as quickly as we can. Banking · Research · Events ... List of qRT-PCR primers. Gene. Forward primer (5' - 3'). Reverse primer (5' - 3'). MMP11. CCGCAACCGACAGAAGAGG. ATCGCTCCATACCTTTAGGGC. GAPDH.
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.