What are environmental DNA (eDNA) analysis?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Mar 15, 2014 ... We used the pBS-gene as our template. We carried out four reactions, which are as followed: T7 (forward primer); T3 (reverse primer). forward primer ATGACAATGAATACGGCTACAGCA . GAPDH reverse primer. GCAGCGAACTTTATTGATGGTATT forward primer. TGCAGAGGATGATTGCTGAC. Bax reverse primer. Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ... COX1. Forward Primer 5'-TCGGAGCCCCAGATATAGCA -3'. Reverse Primer. 5'-TTTCCGGCTAGAGGTGGGTA -3'. COX3. Forward Primer 5'-CAAGGCCACCACACTCCTAT -3'. Oct 29, 2015 ... || symbol can be used in the pattern matching step to include multiple primer sequences. Hope it helps! ADD ... Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study. Apr 3, 2014 ... ... forward primer and complementary sequences in reverse primer via a few bases. The method is different from current methods of nucleic ... PCR Amplification. The primer pairs we use for the PCR amplification of internal fragments of these genes are: Gene, Forward primer 5'-3' sequence, Reverse ... Significant values (*P < 0.05) are indicated nt = nucleotide, rev = reverse primer, fwd = forward primer. To study the impact of a specific mismatch type on PCR ... ... Table S1. RT-PCR primer sequences. Gene. Forward primer, 5' to 3'. Reverse primer, 5' to 3'. CYCLO. CAAATGCTGGACCAAACACA. CAGTCTTGGCGGTGCAGAT. NPC1L1.
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store
  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.