Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

How does the forward primer relate to the reverse primer in PCR?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

the template, and the first fragment's forward primer and the second fragment's reverse primer. were used as the new primer set. The second-round PCR product ... 5' AGGCTGAGAACTCTCGCTTGC 3' Forward Primer. 5' GGTGCTGGTCCTCTGGTATCC 3' Reverse Primer. Murine Cxcl12. 5' CAGCCGTGCAACAATCTGAA 3' Forward Primer. 5 ... Standard Primers. Sequence. Length ; T7 Promoter, 5'-TAA TAC GAC TCA CTA TAG GG-3', 20-mer ; T3 Promoter, 5'-CAA TTA ACC CTC ACT AAA GG-3', 20-mer ; M13 Forward (- ... Jun 14, 2013 ... This newly designed forward primer combined with the “jgHCO2198” reverse primer to target a 313 bp fragment performs well across metazoan diversity. TK. Forward primer (gE592F): CCGCGGGCCGTGTTCTTTGT. 568. gH. Reverse primer (gE1084R): CGTGGCCGTTGTGGGTCAT. 634. gL. Forward primer (gE1066F): ... Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study. In the picture above, the forward primer anneals to the template (-) strand, and is identical to (a part of) the template (+) strand. And the reverse primer ... QuantiMir™ 3' Universal Primer. Keep your QuantiMir studies moving forward with additional universal 3' reverse primer. Forward primer: 5´-GAATTGGAATATGCTAACTGCAACACC-3´. Reverse primer: 5´-GGTGTTGCAGTTAGCATATTCCAATTC-3´. N273A. Forward primer: 5´-TTGGAATATGGTGCCTGCAACACCAAG-3´. PUC/M13 (-40) Forward Primer / 17 mer (2 nmole). Universal primer for sequencing. * Formats: 2 nmole of lyophilized oligo in 1.5 ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.