Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

How does a forward primer differ from a probe?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Full Primer List ; CAT-R · GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer ; CMV Forward, CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human ... Target - If available, choose to query transcribed sequences. Forward Primer - Must be at least 15 bases in length. Reverse Primer - On the opposite strand from ... Jan 9, 2024 ... We developed a simple, accurate and economical approach to genotyping of rs12041331 (PEAR1), rs6065 (GP1BA) and rs730012 (LTC4S) to provide a valuable ... GFP, H1-GFP, T-L7, T-L22 in pIB/V5-His-TOPO vector. GFP. Forward primer 5'- ACCATGGCTAGCAAAGGAGAAGAA -3'. Reverse primer 5'- TTATTTGTAGAGCTCATCCATG -3'. Universal 3' miRNA Reverse Primer. Cat. No. MPH00000. Unit 150 μl / 10 μM. Price $20.00. Add to Cart. ... forward primer, and reverse primer. MOL9069. Copy to clipboard. 25 µL. BKV PRIMER PAIR. For amplification and detection of the 5′ region of the VP2 gene with a ... ... Table S1. RT-PCR primer sequences. Gene. Forward primer, 5' to 3'. Reverse primer, 5' to 3'. CYCLO. CAAATGCTGGACCAAACACA. CAGTCTTGGCGGTGCAGAT. NPC1L1. Jan 5, 2023 ... ... forward primer (10 μM), 1.0 μL reverse primer (10 μM), 0.3 μL exo probe (10 μM), 4.75 μL nuclease-free water, 2.0 μL nucleic acid template ... SDC, Table S1: Primers used for qRT-PCR. Housekeeping Gene. Forward Primer. Reverse Primer β-actin. '5-gacccagatcatgtttgagacc-3'. Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.