How are forward primers used in targeted sequencing panels?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

... forward primer, 1μl RP49 reverse primer, 0.5μl DNA polymerase, 36μl RNase-free H20) that was added to each tube. To test the eve primers, the same PCR mix ... 3' primer (reverse primer) should align to the last 18-20 nucleotides of the anti-sense strand (complement to antisense strand). Make sure a stop codon (TAA ( ... Mar 15, 2014 ... We used the pBS-gene as our template. We carried out four reactions, which are as followed: T7 (forward primer); T3 (reverse primer). Primer Sequences. Gene. COLIAI. COL2A1. GATTCCCTGGACCTAAAGGTGC. CCTGGCAAAGATGGTGAGACAG. COL3A1 ... Forward (5'-3'). Reverse (3'-5'). AGCCTCTCCATCTTTGCCAGCA. Jun 14, 2013 ... This newly designed forward primer combined with the “jgHCO2198” reverse primer to target a 313 bp fragment performs well across metazoan diversity. CAGACCTGCCTTACGACTATGG. Reversed primer. CTCGGTGGCGTTGAGATTGTT. Gpx. Forward primer. CCTTTTAAGCAGTATGCAGGCA. Reversed primer. CAAGCCAAATGGCCCAAGTT. Catalase. Full Primer List ; CAT-R · GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer ; CMV Forward, CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human ... Uses of synthetic primers. edit. Diagrammatic representation of the forward and reverse primers for a standard PCR. For the organic chemistry involved, see ... FAM Forward primer. HEX Reverse primer. FAM. HEX. Base pairs. Base pairs. Forward primer Genus specific probe. Reverse primer. Fig. 4. RFLP analysis of qPCR. Target - If available, choose to query transcribed sequences. Forward Primer - Must be at least 15 bases in length. Reverse Primer - On the opposite strand from ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store
  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.