Cart Login
Funny Santa Hoodie
Thumbnail 2 Thumbnail 3 Thumbnail 4

How are forward primers designed to detect specific parasites?

In Stock

Size Guide

$34.99 $29.99

Shipping and Returns Policy

Catalog #. Primer. Sequence ; Sequencing Primers ; 26-3000-01. M13/pUC (-20); 17 mer. 5'-GTAAAACGACGGCCAGT-3' ; 26-3000-02. M13/pUC Reverse(-24); 16 mer. 5'- ... Primer-BLAST to better identify the template and thus perform better primer specificity checking. A template is not required if both forward and reverse ... ... Table S1. RT-PCR primer sequences. Gene. Forward primer, 5' to 3'. Reverse primer, 5' to 3'. CYCLO. CAAATGCTGGACCAAACACA. CAGTCTTGGCGGTGCAGAT. NPC1L1. Mar 15, 2014 ... We used the pBS-gene as our template. We carried out four reactions, which are as followed: T7 (forward primer); T3 (reverse primer). pJET1.2 Forward Sequencing Primer, 23-mer. Catalog number:SO501. Share Copy product name Copy catalog number Copy catalog number and product name. Sequencing of BioBrick parts ; BBa_G00401, Reverse Primer to C0040, gcggacccactttcacatttaag, R ; BBa_G00700, Forward primer for I0500 (pBAD), agatttatcgccagcagctc ... 3' primer (reverse primer) should align to the last 18-20 nucleotides of the anti-sense strand (complement to antisense strand). Make sure a stop codon (TAA ( ... Forward primer: 5´-GAATTGGAATATGCTAACTGCAACACC-3´. Reverse primer: 5´-GGTGTTGCAGTTAGCATATTCCAATTC-3´. N273A. Forward primer: 5´-TTGGAATATGGTGCCTGCAACACCAAG-3´. Forward primer (5'→3'). Reverse primer (5'→3'). Murine. MMP-3. TGAAAATGAAGGGTCTTCCGG. GCAGAAGCTCCATACCAGCA. MMP-13. GATGGCACTGCTGACATCAT. TGTAGCCTTTGGAACTGCTT. Forward Primer, TGGGACATAGCTTTGTTAGC, 60. 4, Reverse Primer, TGATGCCACTAAACATCAAG. 5, Genotyping Primer, GGGACATAGCTTTGTTAGCTATGCC. 6, SOD2, rs4880, Reverse ...
  • Next Day Delivery by USPS Find out more

    Order by 9pm (excludes Public holidays)

    $11.99

  • Express Delivery - 48 Hours Find out more

    Order by 9pm (excludes Public holidays)

    $9.99

  • Standard Delivery $6.99 Find out more

    Delivered within 3 - 7 days (excludes Public holidays).

  • Store Delivery $6.99 Find out more

    Delivered to your chosen store within 3-7 days

    Spend over $400 (excluding delivery charge) to get a $20 voucher to spend in-store

  • International Delivery Find out more

    International Delivery is available for this product. The cost and delivery time depend on the country.

You can now return your online order in a few easy steps. Select your preferred tracked returns service. We have print at home, paperless and collection options available.

You have 28 days to return your order from the date it’s delivered. Exclusions apply.

View our full Returns and Exchanges information.

Our extended Christmas returns policy runs from 28th October until 5th January 2025, all items purchased online during this time can be returned for a full refund.

No reviews yet. Only logged in customers who have purchased this product may leave a review.